IpiRId allows two input data possibilities for both positive and negative sequences:

• piRNABank format (including sequences and positions in the same file)

>dme_piR_004753|Drosophila_melanogaster:X:12605394:12605417:Minus
TGCTTGCTTGTGTGAGTAAAAACA
>dme_piR_018952|Drosophila_melanogaster:2R:10410943:10410965:Plus
GGTGTCTTTTTCTTGTCTCCCTC

• Fasta & Bed files

• Fasta format

>dme_piR_004753
TGCTTGCTTGTGTGAGTAAAAACA
>dme_piR_018952
GGTGTCTTTTTCTTGTCTCCCTC

• Bed format

chrX	12605394	12605417	dme_piR_004753	5	-
chr2R	10410943	10410965	dme_piR_018952	8	+ 

 

NB: In order to have more accurate predictions, positions of positive and negative sequences must be aligned onto:

• Human hg38 reference genome
• Mouse mm10 reference genome
• Fly dm6 reference genome

For any questions, comments or suggestions about IpiRId, please feel free to contact: fariza.tahi@ibisc.univ-evry.fr