EvryRNA : BiokoP

Secondary structure RNA prediction

BiokoP

Tutorial

    • The sequence should be constituted only with the following nucleotides: A, U, T, G, C, a, u, t, g, c.
    • The length of the input sequence is limited to 130 nucleotides.
    • By checking the box, you can use the following example sequence: AAGCCUUUUGGAUCGAAGGUUAAACGAUCCG
    • Using 1 set returns the optimal solutions.
    • Using more sets returns additional sets of suboptimal solutions
    • This option enables to display RNA secondary structure diagrams :
    • This allows researchers to develop hypotheses about which nucleotides and base pairs are functionally relevant.
      • Kerpedjiev P, Hammer S, Hofacker IL. Forna (force-directed RNA): Simple and effective online RNA secondary structure diagrams. Bioinformatics 31(20):3377-9. 2015. doi:10.1093/bioinformatics/btv372
  • Press CTRL+D on the waiting page, to access results later.
  • Several sets of solutions are displayed depending on the chosen number of Pareto sets.
  • Each hairpins are displayed with the following informations:
    • Energy objective
    • Probability objective
    • RNA secondary structure visualization (if enabled)
  • Nucleotides are colored according to the type of structure that they are in :
    • Green : Stems (canonical helices)
    • Red : Multiloops (junctions)
    • Yellow : Interior loops
    • Blue : Hairpin loops
    • Orange : 5' and 3' unpaired region
  • Pseudoknots are displayed as red lines between nucleotides
  • Result file is a tab-separated text format with 3 columns:
    • Hairpin
    • Energy objective (kcal/mol)
    • Probability objective
  • Each set of solutions is separated by a empty line:
    • Set #1 : Optimal solutions
    • Set #2 : Pareto set of suboptimal solutions #1
    • Set #3 : Pareto set of suboptimal solutions #2
    • Set #4 : Pareto set of suboptimal solutions #3
    • (Additional sets depending on the chosen number of Pareto sets)
OS Version Chrome Firefox Edge Safari
Linux Ubuntu 18.04.3 LTS 79.0 68.0    
macOS Catalina 10.15.1 79.0 72.0   no
Windows 10 79.0 69.0 44  
For any questions, comments or suggestions about miRNAFold, please feel free to contact: fariza.tahi@ibisc.univ-evry.fr