• Click on ncRNAclassifier and download the JAR file
• Download ClustalW from this website : http://www.clustal.org/clustal2/
• Copy the ClustalW binary in the ncRNAClassifier directory

  - On Windows, rename the binary to "clustalw.exe"

  - On Mac OS and Linux, rename the binary to "clustalw2"

   

  

Using ncRNAclassifier interface

• Double click on the JAR file
• OR
• Put "java -jar ncrnaclassifier.jar on a termimal

Using ncRNAClassifier command line on terminal

• Put "java -jar ncrnaclassifier -i 'genome' 'name' 'sequence'"

  - 'genome' is the name of genome where the sequence is (Ex: Human)

  - 'name' is the name of the sequence (Ex: toto)

  - 'sequence' is the sequence of STADEN format (20 nucleotides minimum)(Ex: ACGTAGCTAGATACTACTAG)

• Put "java -jar ncrnaclassifier.jar -h for more options